Transcript: Mouse XM_011244286.1

PREDICTED: Mus musculus inhibin beta-A (Inhba), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Inhba (16323)
Length:
3870
CDS:
2002..3276

Additional Resources:

NCBI RefSeq record:
XM_011244286.1
NBCI Gene record:
Inhba (16323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311429 TGGCAAGTTGCTGGATTATAG pLKO_005 2033 CDS 100% 13.200 18.480 N Inhba n/a
2 TRCN0000376711 TGGCAAGTTGCTGGATTATAG pLKO_005 2033 CDS 100% 13.200 18.480 N INHBA n/a
3 TRCN0000305869 TCTGGCTATCACGCCAATTAT pLKO_005 3022 CDS 100% 15.000 12.000 N Inhba n/a
4 TRCN0000067740 CCTTCCACTCAACAGTCATTA pLKO.1 3095 CDS 100% 13.200 10.560 N Inhba n/a
5 TRCN0000324943 CCTTCCACTCAACAGTCATTA pLKO_005 3095 CDS 100% 13.200 10.560 N Inhba n/a
6 TRCN0000311426 GGCCGAGGAAATGGGCTTAAA pLKO_005 2574 CDS 100% 13.200 9.240 N Inhba n/a
7 TRCN0000305870 AGAGTACCTGGCACATCTTTC pLKO_005 2645 CDS 100% 10.800 7.560 N Inhba n/a
8 TRCN0000067738 GCTGTCAAGAAGCACATCTTA pLKO.1 2170 CDS 100% 5.625 3.938 N Inhba n/a
9 TRCN0000067742 GTGGAGATAGAGGACGACATT pLKO.1 2302 CDS 100% 4.950 3.465 N Inhba n/a
10 TRCN0000067739 CCGTCTATTTCAGCAGCAGAA pLKO.1 2520 CDS 100% 4.050 2.835 N Inhba n/a
11 TRCN0000067741 GCAAGGTCAACATTTGCTGTA pLKO.1 2942 CDS 100% 4.050 2.835 N Inhba n/a
12 TRCN0000059263 GCTGGATTATAGTGAGGAGTT pLKO.1 2042 CDS 100% 4.050 2.835 N INHBA n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3814 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00871 pDONR223 100% 90.6% 96% None (many diffs) n/a
2 ccsbBroad304_00871 pLX_304 0% 90.6% 96% V5 (many diffs) n/a
3 TRCN0000466688 TGTTTTCTAGACTCATTACGACCA pLX_317 25.5% 90.6% 96% V5 (many diffs) n/a
Download CSV