Transcript: Mouse XM_011244372.2

PREDICTED: Mus musculus AU RNA binding protein/enoyl-coenzyme A hydratase (Auh), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Auh (11992)
Length:
1279
CDS:
337..912

Additional Resources:

NCBI RefSeq record:
XM_011244372.2
NBCI Gene record:
Auh (11992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244372.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249164 AGTGGCCAAACTAGCAATTAA pLKO_005 753 CDS 100% 15.000 21.000 N Auh n/a
2 TRCN0000249163 CTGTGCGCCATGTCATATTTA pLKO_005 1050 3UTR 100% 15.000 21.000 N Auh n/a
3 TRCN0000249161 TAAGAAAGTTCGGACCATTAT pLKO_005 101 5UTR 100% 13.200 18.480 N Auh n/a
4 TRCN0000257846 AGATCCGATCGGTGATCAATG pLKO_005 371 CDS 100% 10.800 15.120 N Auh n/a
5 TRCN0000216342 GGATGCATTAAAGTCAGATAA pLKO.1 83 5UTR 100% 13.200 10.560 N Auh n/a
6 TRCN0000249162 GAAACAAAGTTGGCAATTATT pLKO_005 517 CDS 100% 15.000 10.500 N Auh n/a
7 TRCN0000177278 GTTGAAACAAAGTTGGCAATT pLKO.1 514 CDS 100% 10.800 7.560 N Auh n/a
8 TRCN0000215922 CAGATTTATAAAGCTAGCAAT pLKO.1 1073 3UTR 100% 4.950 3.465 N Auh n/a
9 TRCN0000177856 CGGACCATTATCATCAGAAGT pLKO.1 111 5UTR 100% 4.950 3.465 N Auh n/a
10 TRCN0000177065 GCCAAACTAGCAATTAACCAA pLKO.1 757 CDS 100% 3.000 2.100 N Auh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244372.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10692 pDONR223 100% 51.2% 56.7% None (many diffs) n/a
2 ccsbBroad304_10692 pLX_304 0% 51.2% 56.7% V5 (many diffs) n/a
3 TRCN0000481053 CAATGATTCCATAACCTCATAGTC pLX_317 32% 51.2% 56.7% V5 (many diffs) n/a
Download CSV