Transcript: Mouse XM_011244443.1

PREDICTED: Mus musculus predicted gene 3604 (Gm3604), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm3604 (100041979)
Length:
2573
CDS:
455..2038

Additional Resources:

NCBI RefSeq record:
XM_011244443.1
NBCI Gene record:
Gm3604 (100041979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347901 ATATAGAGAGAGACCATATAC pLKO_005 2336 3UTR 100% 13.200 9.240 N Gm3604 n/a
2 TRCN0000347832 TGTAATGCCCAGTTGTCTTAA pLKO_005 784 CDS 100% 13.200 9.240 N Gm3604 n/a
3 TRCN0000347902 TTCTACGAAGGAATTTCATTG pLKO_005 2095 3UTR 100% 10.800 7.560 N Gm3604 n/a
4 TRCN0000347903 TTTCAAACCATAGTAATCTTC pLKO_005 1203 CDS 100% 4.950 3.465 N Gm3604 n/a
5 TRCN0000363955 ACATTGACAGTGATCTCATAA pLKO_005 2497 3UTR 100% 13.200 7.920 N Gm3604 n/a
6 TRCN0000218885 CAGAATCCTTCTGAGTATAAG pLKO_005 2226 3UTR 100% 13.200 6.600 Y Zfp808 n/a
7 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 909 CDS 100% 13.200 6.600 Y Zfp992 n/a
8 TRCN0000021815 CCGGAGAGAAACCTTACAAAT pLKO.1 1077 CDS 100% 13.200 6.600 Y ZNF253 n/a
9 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 825 CDS 100% 13.200 6.600 Y Zfp934 n/a
10 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 825 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
11 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 825 CDS 100% 13.200 6.600 Y EG668616 n/a
12 TRCN0000225752 TGAATATACTCAACGTGATAA pLKO_005 583 CDS 100% 13.200 6.600 Y Zfp808 n/a
13 TRCN0000240176 ACCCTACAAATGTAATCAATG pLKO_005 835 CDS 100% 10.800 5.400 Y n/a
14 TRCN0000218901 GCCCTATGAATGTAATCAATG pLKO_005 751 CDS 100% 10.800 5.400 Y ENSMUSG00000069586 n/a
15 TRCN0000096538 GCAGAGAAACCCTCTGAATAT pLKO.1 569 CDS 100% 1.320 0.660 Y Zfp934 n/a
16 TRCN0000175997 GCAGAGAAACCCTCTGAATAT pLKO.1 569 CDS 100% 1.320 0.660 Y Zfp935 n/a
17 TRCN0000096536 GTGCAGAGAAACCCTCTGAAT pLKO.1 567 CDS 100% 0.495 0.248 Y Zfp934 n/a
18 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 906 CDS 100% 10.800 5.400 Y Gm14308 n/a
19 TRCN0000194048 GCTTTAATTGGGAAGCCCATA pLKO.1 489 CDS 100% 4.050 2.025 Y Zfp935 n/a
20 TRCN0000095226 CATGTGAACTTCACTCAGGAA pLKO.1 386 5UTR 100% 2.640 1.320 Y Zfp950 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.