Transcript: Mouse XM_011244503.2

PREDICTED: Mus musculus zinc finger protein 729a (Zfp729a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp729a (212281)
Length:
5517
CDS:
447..3329

Additional Resources:

NCBI RefSeq record:
XM_011244503.2
NBCI Gene record:
Zfp729a (212281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095233 CTAAGCATAAGAAAGTTCGTA pLKO.1 2323 CDS 100% 3.000 2.100 N Zfp729a n/a
2 TRCN0000095231 GCCTTCTATTATCCATCATTA pLKO.1 3054 CDS 100% 13.200 7.920 N Zfp729a n/a
3 TRCN0000095230 CCTATAACAGTCAAGTATGTA pLKO.1 2272 CDS 100% 5.625 3.375 N Zfp729a n/a
4 TRCN0000095229 CAACCACATGCAGGCTCACAA pLKO.1 3343 3UTR 100% 4.950 2.970 N Zfp729a n/a
5 TRCN0000085225 GCCTTCTGCATTCCATTATTA pLKO.1 870 CDS 100% 15.000 7.500 Y Zfp738 n/a
6 TRCN0000085307 GCCTTCCACTTTCCATCATTA pLKO.1 1038 CDS 100% 13.200 6.600 Y Zfp65 n/a
7 TRCN0000095232 GCCTTCCATTATCCATCAATA pLKO.1 1122 CDS 100% 13.200 6.600 Y Zfp729a n/a
8 TRCN0000096046 CAAATACAAGAGCCTTCAGAT pLKO.1 612 CDS 100% 4.950 2.475 Y Zfp738 n/a
9 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 2762 CDS 100% 4.950 2.475 Y ZNF254 n/a
10 TRCN0000085227 GTCATCACTTTCTAAACACAA pLKO.1 1556 CDS 100% 4.950 2.475 Y Zfp738 n/a
11 TRCN0000095789 CCATCAAGACTTTCCAACCAT pLKO.1 1302 CDS 100% 3.000 1.500 Y Zfp458 n/a
12 TRCN0000096048 TGGAGCAAATACAAGAGCCTT pLKO.1 607 CDS 100% 2.640 1.320 Y Zfp738 n/a
13 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 2008 CDS 100% 13.200 6.600 Y Zfp992 n/a
14 TRCN0000085226 CCCTATAACAGTCAAGTATAT pLKO.1 2271 CDS 100% 13.200 6.600 Y Zfp738 n/a
15 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 2764 CDS 100% 13.200 6.600 Y Zfp934 n/a
16 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 2764 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
17 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 2764 CDS 100% 13.200 6.600 Y EG668616 n/a
18 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 2929 CDS 100% 10.800 5.400 Y Gm14308 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.