Transcript: Mouse XM_011244535.2

PREDICTED: Mus musculus zinc finger protein 874b (Zfp874b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp874b (408067)
Length:
5692
CDS:
2037..3371

Additional Resources:

NCBI RefSeq record:
XM_011244535.2
NBCI Gene record:
Zfp874b (408067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239486 ACCCGATGTAAGAGATATAAA pLKO_005 5257 3UTR 100% 15.000 21.000 N Zfp874b n/a
2 TRCN0000239490 ACAAGCACAAATGCTATAAAT pLKO_005 4440 3UTR 100% 15.000 10.500 N Zfp874b n/a
3 TRCN0000239487 CTGTACTCCAGAGACGTTATA pLKO_005 2398 CDS 100% 13.200 9.240 N Zfp874b n/a
4 TRCN0000239488 TTCTTCTGTGACCGTCAATAT pLKO_005 4555 3UTR 100% 13.200 9.240 N Zfp874b n/a
5 TRCN0000239489 TGCATACTTACCCACAATAAT pLKO_005 5156 3UTR 100% 15.000 9.000 N Zfp874b n/a
6 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 2121 CDS 100% 15.000 7.500 Y ZNF765 n/a
7 TRCN0000419138 ACAACAGGCAATGAATTTAAC pLKO_005 2256 CDS 100% 13.200 6.600 Y Zfp874a n/a
8 TRCN0000420991 AGTGTGAAGAGTGTGGAAATT pLKO_005 2689 CDS 100% 13.200 6.600 Y Zfp874a n/a
9 TRCN0000425337 CAATTCATACTGGAGTTAAAC pLKO_005 2998 CDS 100% 13.200 6.600 Y Zfp874a n/a
10 TRCN0000422844 GCCTTTCTTCATCACTCATAT pLKO_005 2625 CDS 100% 13.200 6.600 Y Zfp874a n/a
11 TRCN0000418176 TGAAGAATGTGGGAAAGTATT pLKO_005 2777 CDS 100% 13.200 6.600 Y Zfp874a n/a
12 TRCN0000436641 AGTGTCAAGAATGTGGCAAAT pLKO_005 2857 CDS 100% 10.800 5.400 Y Zfp874a n/a
13 TRCN0000424972 CATTGATCACAGCTCTCTAAG pLKO_005 2291 CDS 100% 10.800 5.400 Y Zfp874a n/a
14 TRCN0000415116 GAGAGGAACCCTACTACTTTG pLKO_005 2338 CDS 100% 10.800 5.400 Y Zfp874a n/a
15 TRCN0000436450 TAGTTCTCAGGCAACACTTTC pLKO_005 2378 CDS 100% 10.800 5.400 Y Zfp874a n/a
16 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 1130 5UTR 100% 4.950 2.475 Y Gad2 n/a
17 TRCN0000186071 CATTGTCTTCTTTGGGAATTT pLKO.1 1429 5UTR 100% 13.200 6.600 Y Olfr1505 n/a
18 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 2671 CDS 100% 13.200 6.600 Y Zfp934 n/a
19 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 2671 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
20 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 2671 CDS 100% 13.200 6.600 Y EG668616 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.