Transcript: Mouse XM_011244565.2

PREDICTED: Mus musculus transmembrane protein 161B (Tmem161b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem161b (72745)
Length:
5143
CDS:
3236..4153

Additional Resources:

NCBI RefSeq record:
XM_011244565.2
NBCI Gene record:
Tmem161b (72745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179003 CCCTTGCCAGTGGATAATAAT pLKO.1 3914 CDS 100% 15.000 10.500 N Tmem161b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09696 pDONR223 100% 56.8% 58.7% None (many diffs) n/a
2 ccsbBroad304_09696 pLX_304 0% 56.8% 58.7% V5 (many diffs) n/a
3 TRCN0000469018 TAAAGTCATGTCAAGCCTTTAGAC pLX_317 27.9% 56.8% 58.7% V5 (many diffs) n/a
Download CSV