Transcript: Mouse XM_011244573.2

PREDICTED: Mus musculus Rho-related BTB domain containing 3 (Rhobtb3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rhobtb3 (73296)
Length:
4420
CDS:
64..1611

Additional Resources:

NCBI RefSeq record:
XM_011244573.2
NBCI Gene record:
Rhobtb3 (73296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241351 CGCCACTAACTACCTCATATT pLKO_005 1443 CDS 100% 13.200 18.480 N Rhobtb3 n/a
2 TRCN0000241347 TCCCGGAAATGTCGCTGTTTA pLKO_005 1582 CDS 100% 13.200 18.480 N Rhobtb3 n/a
3 TRCN0000048645 GCTTCATTTATTCAGGTGCTT pLKO.1 809 CDS 100% 2.640 3.696 N RHOBTB3 n/a
4 TRCN0000241349 ACTGAGTAGCCTGACTATAAT pLKO_005 2774 3UTR 100% 15.000 10.500 N Rhobtb3 n/a
5 TRCN0000216115 CAAGAACTGATAGACTATTTG pLKO.1 2920 3UTR 100% 13.200 9.240 N Rhobtb3 n/a
6 TRCN0000241350 CAGACATTCTGCGCTTCATTT pLKO_005 797 CDS 100% 13.200 9.240 N Rhobtb3 n/a
7 TRCN0000184301 GCTGGCAGAATACAGGAAGTA pLKO.1 1554 CDS 100% 4.950 2.970 N Rhobtb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07806 pDONR223 100% 73.5% 74.6% None (many diffs) n/a
2 ccsbBroad304_07806 pLX_304 0% 73.5% 74.6% V5 (many diffs) n/a
Download CSV