Transcript: Mouse XM_011244594.2

PREDICTED: Mus musculus predicted gene 3325 (Gm3325), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm3325 (100041420)
Length:
7286
CDS:
2029..4332

Additional Resources:

NCBI RefSeq record:
XM_011244594.2
NBCI Gene record:
Gm3325 (100041420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218440 GCAAAGCTCAGTCATCTTAAA pLKO_005 2497 CDS 100% 13.200 7.920 N EG665420 n/a
2 TRCN0000218885 CAGAATCCTTCTGAGTATAAG pLKO_005 4703 3UTR 100% 13.200 6.600 Y Zfp808 n/a
3 TRCN0000225755 CCGGAGAGAAACCCTACAAAT pLKO_005 3293 CDS 100% 13.200 6.600 Y Zfp808 n/a
4 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 2705 CDS 100% 13.200 6.600 Y Zfp934 n/a
5 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 2705 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
6 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 2705 CDS 100% 13.200 6.600 Y EG668616 n/a
7 TRCN0000225752 TGAATATACTCAACGTGATAA pLKO_005 2295 CDS 100% 13.200 6.600 Y Zfp808 n/a
8 TRCN0000240176 ACCCTACAAATGTAATCAATG pLKO_005 2883 CDS 100% 10.800 5.400 Y n/a
9 TRCN0000240173 ATAACTATCACCTCCACATTC pLKO_005 3257 CDS 100% 10.800 5.400 Y n/a
10 TRCN0000225754 CTATCACCTCCACATTCATAG pLKO_005 3261 CDS 100% 10.800 5.400 Y Zfp808 n/a
11 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 2470 CDS 100% 10.800 5.400 Y Gm14411 n/a
12 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 2787 CDS 100% 4.950 2.475 Y ZNF254 n/a
13 TRCN0000174822 GAAGCTCTACAAAGATGTCAT pLKO.1 2148 CDS 100% 4.950 2.475 Y Zfp935 n/a
14 TRCN0000096538 GCAGAGAAACCCTCTGAATAT pLKO.1 2281 CDS 100% 1.320 0.660 Y Zfp934 n/a
15 TRCN0000175997 GCAGAGAAACCCTCTGAATAT pLKO.1 2281 CDS 100% 1.320 0.660 Y Zfp935 n/a
16 TRCN0000193091 CAAAGGCATGAAAGGATTCAT pLKO.1 2347 CDS 100% 0.563 0.281 Y Zfp935 n/a
17 TRCN0000096536 GTGCAGAGAAACCCTCTGAAT pLKO.1 2279 CDS 100% 0.495 0.248 Y Zfp934 n/a
18 TRCN0000096535 CCCAAAGGCATGAAAGGATTA pLKO.1 2345 CDS 100% 10.800 5.400 Y Zfp934 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.