Transcript: Mouse XM_011244708.2

PREDICTED: Mus musculus importin 11 (Ipo11), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ipo11 (76582)
Length:
2710
CDS:
208..2247

Additional Resources:

NCBI RefSeq record:
XM_011244708.2
NBCI Gene record:
Ipo11 (76582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244708.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217904 GCGAACACTGCTATCGTTAAA pLKO.1 834 CDS 100% 13.200 18.480 N Ipo11 n/a
2 TRCN0000174782 GCAATCTGTAACTTGCTTCAA pLKO.1 1762 CDS 100% 4.950 6.930 N Ipo11 n/a
3 TRCN0000314285 GCAATCTGTAACTTGCTTCAA pLKO_005 1762 CDS 100% 4.950 6.930 N Ipo11 n/a
4 TRCN0000175289 CCATAAGATTAAGATGGCATT pLKO.1 1254 CDS 100% 4.050 5.670 N Ipo11 n/a
5 TRCN0000314348 CCATAAGATTAAGATGGCATT pLKO_005 1254 CDS 100% 4.050 5.670 N Ipo11 n/a
6 TRCN0000193224 CCAGTGCATGAATCTTATTAA pLKO.1 1161 CDS 100% 15.000 10.500 N Ipo11 n/a
7 TRCN0000174323 CCCGAATTACAAGTTTCTCAT pLKO.1 1645 CDS 100% 4.950 3.465 N Ipo11 n/a
8 TRCN0000314284 CCCGAATTACAAGTTTCTCAT pLKO_005 1645 CDS 100% 4.950 3.465 N Ipo11 n/a
9 TRCN0000193260 CCCATTTCATTTACTCCTCTA pLKO.1 1060 CDS 100% 4.050 2.430 N Ipo11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244708.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08248 pDONR223 100% 63.5% 67.7% None (many diffs) n/a
2 ccsbBroad304_08248 pLX_304 0% 63.5% 67.7% V5 (many diffs) n/a
3 TRCN0000491664 GTCGCTCCCCGTTACGTCTCCTAC pLX_317 6.8% 63.5% 67.7% V5 (many diffs) n/a
Download CSV