Transcript: Mouse XM_011244921.2

PREDICTED: Mus musculus methionine sulfoxide reductase A (Msra), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msra (110265)
Length:
2093
CDS:
935..1525

Additional Resources:

NCBI RefSeq record:
XM_011244921.2
NBCI Gene record:
Msra (110265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042096 CAAGTGTTCTACTATGCCGAA pLKO.1 1412 CDS 100% 2.160 3.024 N Msra n/a
2 TRCN0000334725 CAAGTGTTCTACTATGCCGAA pLKO_005 1412 CDS 100% 2.160 3.024 N Msra n/a
3 TRCN0000042094 CGAAGACTACCACCAGCAATA pLKO.1 1429 CDS 100% 10.800 7.560 N Msra n/a
4 TRCN0000042095 CTGGGTCTTGAAAGGAGTGTA pLKO.1 1063 CDS 100% 4.950 3.465 N Msra n/a
5 TRCN0000334723 CTGGGTCTTGAAAGGAGTGTA pLKO_005 1063 CDS 100% 4.950 3.465 N Msra n/a
6 TRCN0000042093 GCCAAGGCAATGACTTTGGTA pLKO.1 1260 CDS 100% 3.000 2.100 N Msra n/a
7 TRCN0000334648 GCCAAGGCAATGACTTTGGTA pLKO_005 1260 CDS 100% 3.000 2.100 N Msra n/a
8 TRCN0000046457 TGGGTCTTGAAAGGAGTGTAT pLKO.1 1064 CDS 100% 4.950 3.465 N MSRA n/a
9 TRCN0000286327 TGGGTCTTGAAAGGAGTGTAT pLKO_005 1064 CDS 100% 4.950 3.465 N MSRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01038 pDONR223 100% 71.2% 71.7% None (many diffs) n/a
2 ccsbBroad304_01038 pLX_304 0% 71.2% 71.7% V5 (many diffs) n/a
3 TRCN0000480533 TGCGCTCTCTAGAGGGTAGACACG pLX_317 51.7% 71.2% 71.7% V5 (many diffs) n/a
Download CSV