Construct: ORF TRCN0000480533
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011763.1_s317c1
- Derived from:
- ccsbBroadEn_01038
- DNA Barcode:
- TGCGCTCTCTAGAGGGTAGACACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MSRA (4482)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480533
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4482 | MSRA | methionine sulfoxide reduct... | NM_012331.5 | 100% | 100% | |
2 | human | 4482 | MSRA | methionine sulfoxide reduct... | XM_017013448.2 | 85.1% | 85.1% | 329_330ins105 |
3 | human | 4482 | MSRA | methionine sulfoxide reduct... | NM_001135670.3 | 82.9% | 82.9% | 210_211ins120 |
4 | human | 4482 | MSRA | methionine sulfoxide reduct... | XM_011543822.2 | 82.2% | 78.2% | (many diffs) |
5 | human | 4482 | MSRA | methionine sulfoxide reduct... | NM_001135671.3 | 80.8% | 79.5% | (many diffs) |
6 | human | 4482 | MSRA | methionine sulfoxide reduct... | XM_011543823.2 | 79.4% | 78.4% | (many diffs) |
7 | human | 4482 | MSRA | methionine sulfoxide reduct... | NM_001199729.3 | 71.9% | 71.9% | 0_1ins198 |
8 | human | 4482 | MSRA | methionine sulfoxide reduct... | XM_017013449.2 | 71.9% | 71.9% | 0_1ins198 |
9 | human | 4482 | MSRA | methionine sulfoxide reduct... | XM_017013450.2 | 71.9% | 71.9% | 0_1ins198 |
10 | human | 4482 | MSRA | methionine sulfoxide reduct... | XM_017013451.2 | 60.8% | 58.2% | (many diffs) |
11 | human | 4482 | MSRA | methionine sulfoxide reduct... | XM_024447162.1 | 50.8% | 48.5% | (many diffs) |
12 | mouse | 110265 | Msra | methionine sulfoxide reduct... | NM_001253712.1 | 82.3% | 85.5% | (many diffs) |
13 | mouse | 110265 | Msra | methionine sulfoxide reduct... | NM_026322.4 | 82.3% | 85.5% | (many diffs) |
14 | mouse | 110265 | Msra | methionine sulfoxide reduct... | XM_011244921.2 | 71.2% | 71.7% | (many diffs) |
15 | mouse | 110265 | Msra | methionine sulfoxide reduct... | NM_001253716.1 | 69.4% | 73.1% | (many diffs) |
16 | mouse | 110265 | Msra | methionine sulfoxide reduct... | NM_001347639.1 | 61.1% | 65.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 771
- ORF length:
- 705
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ctcggccacc cggagggctt gccagctcct cctcctccac agcctctttc 121 ccgtcccgag gatgggcaac tcggcctcga acatcgtcag cccccaggag gccttgccgg 181 gccggaagga acagacccct gtagcggcca aacatcatgt caatggcaac agaacagtcg 241 aacctttccc agagggaaca cagatggctg tatttggaat gggatgtttc tggggagctg 301 aaaggaaatt ctgggtcttg aaaggagtgt attcaactca agttggtttt gcaggaggct 361 atacttcaaa tcctacttat aaagaagtct gctcagaaaa aactggCCAT GCAGAAGTCG 421 TCCGAGTGGT GTACCAGCCA GAACACATGA GTTTTGAGGA ACTGCTCAAG GTCTTCTGGG 481 AGAATCACGA CCCGACCCAA GGTATGCGCC AGGGGAACGA CCATGGCACT CAGTACCGCT 541 CGGCCATCTA CCCGACCTCT GCCAAGCAAA TGGAGGCAGC CCTGAGCTCC AAAGAGAACT 601 ACCAAAAGGT TCTTTCAGAG CACGGCTTCG GCCCCATCAC TACCGACATC CGGGAGGGAC 661 AGACTTTCTA CTATGCGGAA GACTACCACC AGCAGTACCT GAGCAAGAAC CCCAATGGCT 721 ACTGCGGCCT TGGGGGCACC GGCGTGTCCT GCCCAGTGGG TATTAAAAAA TACCCAACTT 781 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 841 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 901 CTTGTGGAAA GGACGATGCG CTCTCTAGAG GGTAGACACG ACGCGTTAAG TCgacaatca 961 acctctggat tacaaaattt gtgaaagatt