Transcript: Mouse XM_011245027.1

PREDICTED: Mus musculus spermatogenesis associated 13 (Spata13), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata13 (219140)
Length:
7010
CDS:
142..3510

Additional Resources:

NCBI RefSeq record:
XM_011245027.1
NBCI Gene record:
Spata13 (219140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346770 TGAACACCGAGCGAGTGTATA pLKO_005 2297 CDS 100% 13.200 18.480 N Spata13 n/a
2 TRCN0000346829 TTCGGCCTTAGTGGATGATAA pLKO_005 1866 CDS 100% 13.200 18.480 N Spata13 n/a
3 TRCN0000363971 TTGCGCAGCTAGCCACTATTT pLKO_005 2387 CDS 100% 13.200 9.240 N Spata13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09869 pDONR223 100% 49.2% 48.8% None (many diffs) n/a
2 ccsbBroad304_09869 pLX_304 0% 49.2% 48.8% V5 (many diffs) n/a
3 TRCN0000472801 GTTAGCTATAAGACTTGCTAATTA pLX_317 19.5% 49.2% 48.8% V5 (many diffs) n/a
Download CSV