Construct: ORF TRCN0000472801
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003362.1_s317c1
- Derived from:
- ccsbBroadEn_09869
- DNA Barcode:
- GTTAGCTATAAGACTTGCTAATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPATA13 (221178)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472801
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221178 | SPATA13 | spermatogenesis associated 13 | NM_153023.4 | 99.9% | 99.8% | 844C>N |
| 2 | human | 221178 | SPATA13 | spermatogenesis associated 13 | NM_001286794.1 | 87.1% | 83% | (many diffs) |
| 3 | human | 221178 | SPATA13 | spermatogenesis associated 13 | NM_001286795.2 | 85.9% | 85.1% | (many diffs) |
| 4 | human | 221178 | SPATA13 | spermatogenesis associated 13 | NM_001286793.2 | 76.5% | 75.6% | (many diffs) |
| 5 | human | 221178 | SPATA13 | spermatogenesis associated 13 | NM_001166271.3 | 51% | 50.9% | 1_1875del;2719C>N |
| 6 | human | 221178 | SPATA13 | spermatogenesis associated 13 | NM_001286792.2 | 48.6% | 48.6% | 1_2061del;2905C>N |
| 7 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | NM_001310594.1 | 75.5% | 76.1% | (many diffs) |
| 8 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | XM_006518870.2 | 75% | 75.6% | (many diffs) |
| 9 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | XM_017315975.1 | 74.3% | 76.2% | (many diffs) |
| 10 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | XM_011245027.1 | 49.2% | 48.8% | (many diffs) |
| 11 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | NM_001033272.2 | 45.1% | 45.5% | (many diffs) |
| 12 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | XM_011245026.1 | 45.1% | 45.5% | (many diffs) |
| 13 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | XM_017315973.1 | 45.1% | 45.5% | (many diffs) |
| 14 | mouse | 219140 | Spata13 | spermatogenesis associated 13 | XM_011245025.1 | 44.7% | 45.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2025
- ORF length:
- 1956
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacttctgcc agccctgaag accagaatgc tccagtgggc tgccccaaag 121 gagcccggag aaggcgcccc atttccgtga taggtggggt cagcttgtat gggaccaacc 181 agacggagga actggacaat cttctgaccc aaccggcttc caggccgccc atgcctgctc 241 accaggtgcc accctacaag gctgtgtcgg cccggttccg gcccttcaca ttctcccaga 301 gcacccccat tgggttggac cgtgtgggac gccggcggca gatgagagca tccaacgttt 361 cttcagatgg aggtactgag ccctctgcct tagtggatga caacggtagt gaggaggact 421 tcagctatga agacctctgc caggccagcc ctcggtacct gcagcccggc ggggagcagc 481 tggccatcaa tgagctgatc agtgatggca acgtggtctg cgcagaagcc ctgtgggacc 541 atgtgaccat ggatgaccag gaactgggct tcaaagccgg ggatgtcatc caggttctgg 601 aagcctccaa caaggactgg tggtggggcc gcagtgaaga taaggaagcc tggttccccg 661 cgagcttcgt cagattgcga gtgaatcagg aagagctgtc ggaaaactcc agcagcaccc 721 ccagtgagga gcaggacgag gaggccagcc agagccgcca cagacactgt gagaacaagc 781 agcagatgcg gaccaacgtc atccgggaga tcatggacac cgagcgggtg tacatcaaac 841 acctcaggga catctgtgag ggctatatcc gacagtgccg caagcacaca ggaatgttca 901 ccgttgcgca gntagccact atttttggaa acattgaaga tatttacaaa ttccaaagaa 961 agtttctgaa agaccttgag aaacagtaca acaaagagga acctcactta agtgaaatag 1021 gatcttgctt tcttcaaaat caagagggct ttgccatcta ttccgagtac tgcaacaacc 1081 acccgggcgc ctgcctggag ctcgccaacc tcatgaagca gggcaagtac agacatttct 1141 ttgaagcctg ccgcctgctg cagcagatga ttgacatcgc catcgacggg ttcctgctca 1201 caccagtgca gaagatctgc aaatacccgc tgcagctggc cgagctgctc aagtatacca 1261 cacaggaaca cggtgattac agcaacataa aggcagcata tgaggccatg aagaatgtgg 1321 cctgtctgat caacgagcgc aagcgcaagc tggagagcat cgacaagata gctcgctggc 1381 aggtgtctat cgtgggctgg gagggactgg atatcttaga ccgaagctca gaattgattc 1441 attctgggga gctgaccaaa atcactaagc aaggcaaaag ccagcagcgg acgttcttcc 1501 tgtttgacca ccagctggtg tcctgcaaga aggacctgct gcgcagggac atgctgtact 1561 acaagggccg gctggacatg gatgagatgg agcttgtgga cctgggggat gggcgcgaca 1621 aggactgcaa cctcagcgtg aaaaatgccT TCAAGCTCGT CAGTAGGACC ACAGACGAGG 1681 TTTATTTGTT TTGTGCCAAA AAACAAGAAG ACAAGGCGAG GTGGCTGCAG GCCTGTGCAG 1741 ATGAAAGGAG GCGGGTGCAA GAGGACAAGG AGATGGGAAT GGAAATTTCA GAAAACCAGA 1801 AGAAACTTGC CATGTTAAAT GCTCAAAAGG CAGGACATGG AAAGTCAAAA GGCTACAACA 1861 GGTGCCCTGT GGCCCCACCG CACCAGGGCC TGCACCCCAT CCACCAGCGC CACATCACTA 1921 TGCCCACAAG CGTCCCCCAG CAGCAGGTCT TTGGCCTGGC GGAACCCAAG AGGAAGTCCT 1981 CGCTCTTCTG GCACACCTTC AACAGGCTCA CCCCCTTCCG GAAATTGCCA ACTTTCTTGT 2041 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2101 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2161 GAAAGGACGA GTTAGCTATA AGACTTGCTA ATTAACGCGT TAAGTCgaca atcaacctct 2221 ggattacaaa atttgtgaaa gatt