Transcript: Mouse XM_011245151.2

PREDICTED: Mus musculus purine-nucleoside phosphorylase 2 (Pnp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pnp2 (667034)
Length:
1475
CDS:
187..1200

Additional Resources:

NCBI RefSeq record:
XM_011245151.2
NBCI Gene record:
Pnp2 (667034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263193 ATTCCACTCCCGGAGTGTAAC pLKO_005 1171 CDS 100% 10.800 8.640 N Pnp2 n/a
2 TRCN0000282524 GATGTGCTGCTTCTCTAATTC pLKO_005 1248 3UTR 100% 13.200 9.240 N Pnp2 n/a
3 TRCN0000263192 TTGATTTGACACTGCCTTCAC pLKO_005 1281 3UTR 100% 4.050 2.835 N Pnp2 n/a
4 TRCN0000193142 CTTCTGCAACACACTGAATAT pLKO.1 376 CDS 100% 13.200 6.600 Y Pnp n/a
5 TRCN0000376029 ACAATGAGATACCCAACTTTC pLKO_005 476 CDS 100% 10.800 5.400 Y Pnp n/a
6 TRCN0000282526 CAGACTGTATGCCACTGAGGT pLKO_005 1217 3UTR 100% 2.640 1.320 Y Pnp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.