Transcript: Mouse XM_011245206.2

PREDICTED: Mus musculus ring finger protein 219 (Rnf219), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf219 (72486)
Length:
1926
CDS:
102..746

Additional Resources:

NCBI RefSeq record:
XM_011245206.2
NBCI Gene record:
Rnf219 (72486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125458 CTGGCCGATAATCCAAGTAAA pLKO.1 534 CDS 100% 13.200 18.480 N Rnf219 n/a
2 TRCN0000434050 AGATGATGTGGATAAGTTAAA pLKO_005 626 CDS 100% 13.200 9.240 N Rnf219 n/a
3 TRCN0000417539 AGACCATTCTGGATCCTTTAG pLKO_005 475 CDS 100% 10.800 7.560 N Rnf219 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12571 pDONR223 100% 19.4% 19.7% None (many diffs) n/a
2 ccsbBroad304_12571 pLX_304 0% 19.4% 19.7% V5 (many diffs) n/a
3 TRCN0000473310 CGGCGCGGGCATTGTATCTGGCCC pLX_317 23.6% 19.4% 19.7% V5 (many diffs) n/a
Download CSV