Transcript: Mouse XM_011245660.2

PREDICTED: Mus musculus sterile alpha motif domain containing 12 (Samd12), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Samd12 (320679)
Length:
826
CDS:
155..718

Additional Resources:

NCBI RefSeq record:
XM_011245660.2
NBCI Gene record:
Samd12 (320679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249289 GTAGAATCTCAATCCATTAAA pLKO_005 251 CDS 100% 15.000 21.000 N Samd12 n/a
2 TRCN0000183642 GTGTAGAATCTCAATCCATTA pLKO.1 249 CDS 100% 10.800 15.120 N Samd12 n/a
3 TRCN0000249286 CAGCTCTACAGTGAGTCATTC pLKO_005 437 CDS 100% 10.800 8.640 N Samd12 n/a
4 TRCN0000249290 TGCCCATGCTGACGGAATTAA pLKO_005 208 CDS 100% 15.000 10.500 N Samd12 n/a
5 TRCN0000249287 CTGAAGAAACACTGTCCAAAT pLKO_005 410 CDS 100% 10.800 7.560 N Samd12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05645 pDONR223 100% 75% 70.5% None (many diffs) n/a
2 ccsbBroad304_05645 pLX_304 0% 75% 70.5% V5 (many diffs) n/a
3 TRCN0000475460 CGTATAAGACGAATGCCGAGTAGC pLX_317 13.7% 75% 70.5% V5 (many diffs) n/a
Download CSV