Transcript: Mouse XM_011245717.2

PREDICTED: Mus musculus RAB, member RAS oncogene family-like 2 (Rabl2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rabl2 (68708)
Length:
1681
CDS:
442..858

Additional Resources:

NCBI RefSeq record:
XM_011245717.2
NBCI Gene record:
Rabl2 (68708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421812 GGTACATGATGAGGTCAATAC pLKO_005 978 3UTR 100% 10.800 8.640 N Rabl2 n/a
2 TRCN0000432419 TTTGACAGACAACCATTAATT pLKO_005 1289 3UTR 100% 15.000 10.500 N Rabl2 n/a
3 TRCN0000427514 ATATGCTCTGACTCTGTATAA pLKO_005 345 5UTR 100% 13.200 9.240 N Rabl2 n/a
4 TRCN0000437921 ATGCATCCTGGTGGCCAATAA pLKO_005 567 CDS 100% 13.200 9.240 N Rabl2 n/a
5 TRCN0000048164 TCCAAACTCATGGAGAGATTT pLKO.1 235 5UTR 100% 13.200 9.240 N RABL2B n/a
6 TRCN0000413371 ATGTTGTGAAGCTCTTCAATG pLKO_005 683 CDS 100% 10.800 7.560 N RABL2A n/a
7 TRCN0000446559 GAAACTAGACAGGCGTGATAC pLKO_005 1002 3UTR 100% 10.800 7.560 N Rabl2 n/a
8 TRCN0000100886 GCAGACATACAGATGACTCAA pLKO.1 595 CDS 100% 4.950 3.465 N Rabl2 n/a
9 TRCN0000100889 GTCCAAACTCATGGAGAGATT pLKO.1 234 5UTR 100% 4.950 3.465 N Rabl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02634 pDONR223 100% 53.1% 48.9% None (many diffs) n/a
2 ccsbBroad304_02634 pLX_304 0% 53.1% 48.9% V5 (many diffs) n/a
3 TRCN0000472616 CTCATTTTTGCCGTATCCGTGCAC pLX_317 77% 53.1% 48.9% V5 (many diffs) n/a
4 ccsbBroadEn_11605 pDONR223 100% 52.5% 49.5% None (many diffs) n/a
5 ccsbBroad304_11605 pLX_304 0% 52.5% 49.5% V5 (many diffs) n/a
6 TRCN0000468953 ATCGAGGGTCCACGTACCTGTACT pLX_317 56.6% 52.5% 49.5% V5 (many diffs) n/a
Download CSV