Transcript: Mouse XM_011245737.1

PREDICTED: Mus musculus spermatogenesis associated, serine-rich 2 (Spats2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spats2 (72572)
Length:
2995
CDS:
504..2141

Additional Resources:

NCBI RefSeq record:
XM_011245737.1
NBCI Gene record:
Spats2 (72572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215930 CGAATTGCAAAGCTGTTTAAT pLKO.1 1328 CDS 100% 15.000 21.000 N Spats2 n/a
2 TRCN0000250958 CGAATTGCAAAGCTGTTTAAT pLKO_005 1328 CDS 100% 15.000 21.000 N Spats2 n/a
3 TRCN0000250960 TTTGTCAGTGAGCGGAAATAT pLKO_005 1515 CDS 100% 15.000 21.000 N Spats2 n/a
4 TRCN0000250959 CATCAATGGTTACCACGTAAA pLKO_005 884 CDS 100% 10.800 15.120 N Spats2 n/a
5 TRCN0000216611 GCTCAAAGAATGGATAGTAAC pLKO.1 734 CDS 100% 10.800 15.120 N Spats2 n/a
6 TRCN0000250961 TCTTTGACTGCGCACTCTATC pLKO_005 1068 CDS 100% 10.800 15.120 N Spats2 n/a
7 TRCN0000189881 CGGACAAGTGTCACATCCAAA pLKO.1 1607 CDS 100% 4.950 3.960 N Spats2 n/a
8 TRCN0000190194 CACTTTGTCAGTGAGCGGAAA pLKO.1 1512 CDS 100% 4.050 2.835 N Spats2 n/a
9 TRCN0000265261 CCACTCTCTTCCACCAATAAA pLKO_005 1179 CDS 100% 15.000 9.000 N Spats2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.