Transcript: Mouse XM_011245778.3

PREDICTED: Mus musculus transcriptional repressor GATA binding 1 (Trps1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Trps1 (83925)
Length:
10416
CDS:
620..4498

Additional Resources:

NCBI RefSeq record:
XM_011245778.3
NBCI Gene record:
Trps1 (83925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245778.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020497 CGGACAAATATGACTTCACAA pLKO.1 4410 CDS 100% 4.950 6.930 N TRPS1 n/a
2 TRCN0000082335 GCTTACCAAATCCTTGCCAAA pLKO.1 4050 CDS 100% 4.050 5.670 N Trps1 n/a
3 TRCN0000082334 CCGCTGCAAATTCTGCAATTT pLKO.1 1618 CDS 100% 1.320 1.848 N Trps1 n/a
4 TRCN0000418190 AGCATCTTTGCACGGACAAAT pLKO_005 4398 CDS 100% 13.200 10.560 N Trps1 n/a
5 TRCN0000082333 CCTTAGCACTTAGCACAATTA pLKO.1 4501 3UTR 100% 13.200 9.240 N Trps1 n/a
6 TRCN0000413696 ACGGACAAGAAAGCGCCTTAA pLKO_005 3493 CDS 100% 10.800 7.560 N Trps1 n/a
7 TRCN0000082337 CCCAGGCCTTTAAACATCATT pLKO.1 3440 CDS 100% 5.625 3.938 N Trps1 n/a
8 TRCN0000082336 CGGCCTTAATCCAGAGTTGAA pLKO.1 2014 CDS 100% 4.950 3.465 N Trps1 n/a
9 TRCN0000245305 ATATGGTAACGAGCTATAATT pLKO_005 2172 CDS 100% 15.000 10.500 N TRPS1 n/a
10 TRCN0000020496 GCGGCCTTAATCCAGAGTTAA pLKO.1 2013 CDS 100% 13.200 9.240 N TRPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245778.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11204 pDONR223 100% 59.4% 60.3% None (many diffs) n/a
2 ccsbBroad304_11204 pLX_304 0% 59.4% 60.3% V5 (many diffs) n/a
3 TRCN0000473025 TACGCAACTGGGAAACCCCCGGTC pLX_317 21.4% 59.4% 60.3% V5 (many diffs) n/a
Download CSV