Transcript: Mouse XM_011245796.2

PREDICTED: Mus musculus queuine tRNA-ribosyltransferase domain containing 1 (Qtrtd1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Qtrt2 (106248)
Length:
2985
CDS:
444..1322

Additional Resources:

NCBI RefSeq record:
XM_011245796.2
NBCI Gene record:
Qtrt2 (106248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093837 CGTGCGTATATCCACCATCTT pLKO.1 1155 CDS 100% 4.950 6.930 N Qtrt2 n/a
2 TRCN0000093835 GCAGAATATAAGAAAGGAGTT pLKO.1 374 5UTR 100% 4.050 3.240 N Qtrt2 n/a
3 TRCN0000093834 GCCCTGACTTTCACCTTTGAT pLKO.1 927 CDS 100% 5.625 3.938 N Qtrt2 n/a
4 TRCN0000093836 TGTGCAGAAACAACTTCCATA pLKO.1 525 CDS 100% 4.950 3.465 N Qtrt2 n/a
5 TRCN0000093838 CCTGAGGAGACACTATTGCAA pLKO.1 960 CDS 100% 3.000 2.100 N Qtrt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08946 pDONR223 100% 60.3% 62.6% None (many diffs) n/a
2 ccsbBroad304_08946 pLX_304 0% 60.3% 62.6% V5 (many diffs) n/a
Download CSV