Transcript: Mouse XM_011245806.1

PREDICTED: Mus musculus adenylate cyclase 9 (Adcy9), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adcy9 (11515)
Length:
7253
CDS:
123..4241

Additional Resources:

NCBI RefSeq record:
XM_011245806.1
NBCI Gene record:
Adcy9 (11515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114988 GCGATCATATAGAACCAGCTA pLKO.1 2459 CDS 100% 2.640 3.696 N Adcy9 n/a
2 TRCN0000114987 CCCTTTAAGATGCAGCAGATT pLKO.1 1272 CDS 100% 4.950 3.960 N Adcy9 n/a
3 TRCN0000114986 GCACAGTTATTCAGGGTTCAT pLKO.1 4386 3UTR 100% 4.950 3.960 N Adcy9 n/a
4 TRCN0000114990 CCCTTCTTGTGGAATCACATT pLKO.1 2012 CDS 100% 4.950 3.465 N Adcy9 n/a
5 TRCN0000114989 GCTGTCCACATGAAATCCAAA pLKO.1 525 CDS 100% 4.950 3.465 N Adcy9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05773 pDONR223 100% 85.5% 90.8% None (many diffs) n/a
2 ccsbBroad304_05773 pLX_304 0% 85.5% 90.8% V5 (many diffs) n/a
3 TRCN0000475791 AAAAGGGTTAAATCTTGTTTCGAC pLX_317 9.1% 85.5% 90.8% V5 (many diffs) n/a
Download CSV