Transcript: Mouse XM_011245993.2

PREDICTED: Mus musculus rogdi homolog (Rogdi), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rogdi (66049)
Length:
610
CDS:
53..595

Additional Resources:

NCBI RefSeq record:
XM_011245993.2
NBCI Gene record:
Rogdi (66049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012236 GCCTCGGAACAACCAGTTGTT pLKO.1 325 CDS 100% 0.495 0.347 N Rogdi n/a
2 TRCN0000012235 GAACCATGTGAGCCAAGCTAT pLKO.1 403 CDS 100% 4.950 2.970 N Rogdi n/a
3 TRCN0000321275 GAACCATGTGAGCCAAGCTAT pLKO_005 403 CDS 100% 4.950 2.970 N Rogdi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08941 pDONR223 100% 54.9% 57.4% None (many diffs) n/a
2 ccsbBroad304_08941 pLX_304 0% 54.9% 57.4% V5 (many diffs) n/a
3 TRCN0000478692 CTCGTTACAATCCGGCTCGAGTAC pLX_317 42.6% 54.9% 57.4% V5 (many diffs) n/a
Download CSV