Transcript: Mouse XM_011246023.2

PREDICTED: Mus musculus poly(A)-specific ribonuclease (deadenylation nuclease) (Parn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Parn (74108)
Length:
2160
CDS:
171..1988

Additional Resources:

NCBI RefSeq record:
XM_011246023.2
NBCI Gene record:
Parn (74108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193565 GAGAGATATCAGAAGCTTAAA pLKO.1 324 CDS 100% 13.200 9.240 N Parn n/a
2 TRCN0000193676 CCTGAATGAGTTTAAGGAGAT pLKO.1 1013 CDS 100% 4.050 2.835 N Parn n/a
3 TRCN0000173297 GCCTTCGGTAACATTCAGATT pLKO.1 1491 CDS 100% 4.950 3.960 N Parn n/a
4 TRCN0000049744 CCCAGACTCTTGGATACTAAA pLKO.1 1050 CDS 100% 13.200 9.240 N PARN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01146 pDONR223 100% 82% 83.5% None (many diffs) n/a
2 ccsbBroad304_01146 pLX_304 0% 82% 83.5% V5 (many diffs) n/a
3 TRCN0000478950 AAAGAAAACACCACATCATTTCTC pLX_317 20.5% 82% 83.5% V5 (many diffs) n/a
Download CSV