Transcript: Mouse XM_011246309.2

PREDICTED: Mus musculus hyaluronan synthase1 (Has1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Has1 (15116)
Length:
2711
CDS:
644..2413

Additional Resources:

NCBI RefSeq record:
XM_011246309.2
NBCI Gene record:
Has1 (15116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431505 GATACTGGGTAGCCTTCAATG pLKO_005 1527 CDS 100% 10.800 15.120 N HAS1 n/a
2 TRCN0000222356 CGAGCACTCACGATCATCTTT pLKO.1 722 CDS 100% 5.625 7.875 N Has1 n/a
3 TRCN0000222355 CGAATGCTTAGCATGGGCTAT pLKO.1 1709 CDS 100% 4.050 5.670 N Has1 n/a
4 TRCN0000222358 CCCGCCACTTATGTGTGGGAT pLKO.1 1142 CDS 100% 0.880 1.232 N Has1 n/a
5 TRCN0000222357 CCGCTGGTCCAAATCTTACTT pLKO.1 1807 CDS 100% 5.625 4.500 N Has1 n/a
6 TRCN0000222354 GCGTTGGTTACCATGAATCAA pLKO.1 2111 CDS 100% 5.625 4.500 N Has1 n/a
7 TRCN0000045383 CAGAGCTACTTCCACTGTGTA pLKO.1 1562 CDS 100% 4.950 2.970 N HAS1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 422 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487994 CTGAAGCCCTCGAGTCATAATCTA pLX_317 18.9% 83.2% 94.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV