Transcript: Mouse XM_011247096.2

PREDICTED: Mus musculus CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 (Ctdp1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctdp1 (67655)
Length:
3554
CDS:
352..2877

Additional Resources:

NCBI RefSeq record:
XM_011247096.2
NBCI Gene record:
Ctdp1 (67655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305854 TACCCGCACACATAGGGATAA pLKO_005 2160 CDS 100% 0.000 0.000 N Ctdp1 n/a
2 TRCN0000080974 CCGAGTACACACTGACTATTA pLKO.1 1758 CDS 100% 13.200 9.240 N Ctdp1 n/a
3 TRCN0000324820 CCGAGTACACACTGACTATTA pLKO_005 1758 CDS 100% 13.200 9.240 N Ctdp1 n/a
4 TRCN0000305853 TTGAGGAAGCTCCAGATATAC pLKO_005 1811 CDS 100% 13.200 9.240 N Ctdp1 n/a
5 TRCN0000305855 ACGACGATGACCACTTGATAC pLKO_005 1718 CDS 100% 10.800 7.560 N Ctdp1 n/a
6 TRCN0000080975 CCGAGAAGATGTGTGGAAGTT pLKO.1 903 CDS 100% 4.950 3.465 N Ctdp1 n/a
7 TRCN0000080977 CCAGATGTCCAACAAAGGCAT pLKO.1 600 CDS 100% 2.640 1.848 N Ctdp1 n/a
8 TRCN0000080973 CCAGTAAGATTTAGAGAGCAA pLKO.1 3184 3UTR 100% 2.640 1.848 N Ctdp1 n/a
9 TRCN0000324821 CCAGTAAGATTTAGAGAGCAA pLKO_005 3184 3UTR 100% 2.640 1.848 N Ctdp1 n/a
10 TRCN0000080976 GCACCCAACAAACTTTCCTGT pLKO.1 1896 CDS 100% 2.640 1.848 N Ctdp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.