Transcript: Mouse XM_011247341.1

PREDICTED: Mus musculus Rho GTPase activating protein 19 (Arhgap19), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap19 (71085)
Length:
5071
CDS:
16..1473

Additional Resources:

NCBI RefSeq record:
XM_011247341.1
NBCI Gene record:
Arhgap19 (71085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191107 GCTGATTGAATATCTGCACAA pLKO.1 369 CDS 100% 4.050 3.240 N Arhgap19 n/a
2 TRCN0000192761 CAGCAACATCACAAGGCTTAT pLKO.1 174 CDS 100% 10.800 7.560 N Arhgap19 n/a
3 TRCN0000201329 GCTCCAGAACTCAAATGTCAA pLKO.1 959 CDS 100% 4.950 3.465 N Arhgap19 n/a
4 TRCN0000201124 CCAACTGGTATTTGAGGCTTT pLKO.1 1866 3UTR 100% 4.050 2.835 N Arhgap19 n/a
5 TRCN0000191390 CTTTATTACTTCTGTCCTCTA pLKO.1 1481 3UTR 100% 4.050 2.835 N Arhgap19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04462 pDONR223 100% 83.4% 85.6% None (many diffs) n/a
2 ccsbBroad304_04462 pLX_304 0% 83.4% 85.6% V5 (many diffs) n/a
Download CSV