Transcript: Mouse XM_011247476.1

PREDICTED: Mus musculus jade family PHD finger 3 (Jade3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jade3 (382207)
Length:
5134
CDS:
539..3091

Additional Resources:

NCBI RefSeq record:
XM_011247476.1
NBCI Gene record:
Jade3 (382207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104054 CCTGACTCTCACCATGTTAAT pLKO.1 704 CDS 100% 13.200 9.240 N Jade3 n/a
2 TRCN0000104050 CCACTGGATATGAATGTGAAA pLKO.1 2372 CDS 100% 4.950 3.465 N Jade3 n/a
3 TRCN0000104053 GCACTAGAGAACTCACTGTTT pLKO.1 2198 CDS 100% 4.950 3.465 N Jade3 n/a
4 TRCN0000104051 GCCCAATTGATGAGACTCTTA pLKO.1 1101 CDS 100% 4.950 3.465 N Jade3 n/a
5 TRCN0000104052 GCTTCATATCAGGAAACTGAT pLKO.1 2894 CDS 100% 0.495 0.347 N Jade3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14027 pDONR223 100% 82% 78.6% None (many diffs) n/a
2 ccsbBroad304_14027 pLX_304 0% 82% 78.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000492349 GGGCCCACGGTCCAATCTCCTTTG pLX_317 13.5% 82% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV