Transcript: Mouse XM_011247485.2

PREDICTED: Mus musculus kelch-like 13 (Klhl13), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhl13 (67455)
Length:
2942
CDS:
289..2271

Additional Resources:

NCBI RefSeq record:
XM_011247485.2
NBCI Gene record:
Klhl13 (67455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216641 CTGACAATACTTGCGTCAATT pLKO.1 1214 CDS 100% 13.200 18.480 N Klhl13 n/a
2 TRCN0000192099 CGTCGATACAGTGTTTAGATT pLKO.1 1524 CDS 100% 5.625 7.875 N Klhl13 n/a
3 TRCN0000190762 GCTGTGAATACTACTCACCTA pLKO.1 1970 CDS 100% 2.640 3.696 N Klhl13 n/a
4 TRCN0000215652 GATCCAAGTTGCATCTTTAAA pLKO.1 1566 CDS 100% 15.000 12.000 N Klhl13 n/a
5 TRCN0000202289 GCCGTTTATGCAGCCAGTTAT pLKO.1 1266 CDS 100% 13.200 10.560 N Klhl13 n/a
6 TRCN0000190389 CCATCTGACAGAAGTGGATAA pLKO.1 921 CDS 100% 10.800 7.560 N Klhl13 n/a
7 TRCN0000189744 GCAGGAAGTACACGCATCTTT pLKO.1 490 CDS 100% 5.625 3.938 N Klhl13 n/a
8 TRCN0000192007 CCTTCAGTAATTGATACAGAA pLKO.1 2368 3UTR 100% 4.950 3.465 N Klhl13 n/a
9 TRCN0000135888 GAATGGACCTATGTTGCCAAA pLKO.1 1702 CDS 100% 4.050 2.835 N KLHL13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08613 pDONR223 100% 77.1% 82.8% None (many diffs) n/a
2 ccsbBroad304_08613 pLX_304 0% 77.1% 82.8% V5 (many diffs) n/a
3 TRCN0000480620 CGGATATTAATTAGCAACCTAAAC pLX_317 19.4% 77.1% 82.8% V5 (many diffs) n/a
Download CSV