Transcript: Mouse XM_011247659.2

PREDICTED: Mus musculus family with sequence similarity 3, member A (Fam3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam3a (66294)
Length:
1621
CDS:
233..1000

Additional Resources:

NCBI RefSeq record:
XM_011247659.2
NBCI Gene record:
Fam3a (66294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264792 GAGCACCTGAGCTTTCGAATA pLKO_005 434 CDS 100% 10.800 15.120 N Fam3a n/a
2 TRCN0000264791 TAACACATTAGGGCTTGAAAG pLKO_005 1097 3UTR 100% 10.800 15.120 N Fam3a n/a
3 TRCN0000215925 CAGTGATCCTTTAAGCCAAAT pLKO.1 1420 3UTR 100% 10.800 8.640 N Fam3a n/a
4 TRCN0000198009 CCTAATCATCATTATGGGTCT pLKO.1 265 CDS 100% 2.160 1.728 N Fam3a n/a
5 TRCN0000283180 CAAGGGCCAGGAAGTACAAAT pLKO_005 387 CDS 100% 13.200 9.240 N Fam3a n/a
6 TRCN0000264794 TCGTGGCCCTAATCATCATTA pLKO_005 258 CDS 100% 13.200 9.240 N Fam3a n/a
7 TRCN0000379144 ATCCAGCTACCAAGATGAATG pLKO_005 765 CDS 100% 10.800 7.560 N Fam3a n/a
8 TRCN0000217291 GTTGGGACATCTTCAAGAAAC pLKO.1 1357 3UTR 100% 10.800 7.560 N Fam3a n/a
9 TRCN0000379219 TGAACATCGCCCTGGTGAATG pLKO_005 546 CDS 100% 10.800 7.560 N Fam3a n/a
10 TRCN0000264793 TGCTCATGAGCAGCGTCAAAG pLKO_005 507 CDS 100% 10.800 7.560 N Fam3a n/a
11 TRCN0000155950 CCAAGATGAATGAAGAGACCA pLKO.1 774 CDS 100% 2.640 1.848 N FAM3A n/a
12 TRCN0000182441 GAATGAAGAGACCAGGAAGCT pLKO.1 781 CDS 100% 2.640 1.848 N Fam3a n/a
13 TRCN0000198482 GCAGCATATGAAGAACAGTAA pLKO.1 901 CDS 100% 0.000 0.000 N Fam3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03882 pDONR223 100% 77.4% 81.9% None (many diffs) n/a
2 ccsbBroad304_03882 pLX_304 0% 77.4% 81.9% V5 (many diffs) n/a
3 TRCN0000471077 GCAGGATCGCGCATTTGTCGATGC pLX_317 63.9% 77.4% 81.9% V5 (many diffs) n/a
Download CSV