Transcript: Mouse XM_011247674.2

PREDICTED: Mus musculus ankyrin repeat and SOCS box-containing 12 (Asb12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asb12 (70392)
Length:
2351
CDS:
496..1422

Additional Resources:

NCBI RefSeq record:
XM_011247674.2
NBCI Gene record:
Asb12 (70392)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192921 GCAGCTTCTTATGGTCACTTA pLKO.1 706 CDS 100% 4.950 6.930 N Asb12 n/a
2 TRCN0000189448 CCCGTTTAGTTATCCGCAGAT pLKO.1 1319 CDS 100% 4.050 5.670 N Asb12 n/a
3 TRCN0000189529 CTTGATTGTTTCCGCCTGCTT pLKO.1 1048 CDS 100% 2.640 3.696 N Asb12 n/a
4 TRCN0000191646 GAGGCTAATGTCAAAGCTAAA pLKO.1 958 CDS 100% 10.800 7.560 N Asb12 n/a
5 TRCN0000191702 CAAGATGATAAAGGCATCAAA pLKO.1 1252 CDS 100% 5.625 3.938 N Asb12 n/a
6 TRCN0000192517 GCTTGGATGTCAAAGCACAAA pLKO.1 770 CDS 100% 4.950 3.465 N Asb12 n/a
7 TRCN0000216813 GAACATGGTGCTGATGTTGAT pLKO.1 748 CDS 100% 0.495 0.347 N Asb12 n/a
8 TRCN0000139010 CTAAACTACCAGTCTGGGCAT pLKO.1 974 CDS 100% 2.160 1.512 N ASB12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.