Transcript: Mouse XM_011247802.2

PREDICTED: Mus musculus family with sequence similarity 120, member C (Fam120c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam120c (207375)
Length:
3911
CDS:
1319..3712

Additional Resources:

NCBI RefSeq record:
XM_011247802.2
NBCI Gene record:
Fam120c (207375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193763 CCTTAAAGAGTGGTCTGCATA pLKO.1 3379 CDS 100% 4.950 6.930 N Fam120c n/a
2 TRCN0000194430 CGTCCTTACTAAGGGTGAGAT pLKO.1 3181 CDS 100% 4.950 6.930 N Fam120c n/a
3 TRCN0000193617 GCTGTTTCTTATGACTCTAAT pLKO.1 2789 CDS 100% 13.200 9.240 N Fam120c n/a
4 TRCN0000442962 ACACGCCCAGTATGCTCAATC pLKO_005 3549 CDS 100% 10.800 7.560 N FAM120C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14179 pDONR223 100% 14.6% 4.5% None (many diffs) n/a
2 ccsbBroad304_14179 pLX_304 0% 14.6% 4.5% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474860 ACACTCGTGGTCCCACACTGTTTC pLX_317 100% 14.6% 4.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV