Transcript: Mouse XM_011247833.2

PREDICTED: Mus musculus FERM and PDZ domain containing 4 (Frmpd4), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Frmpd4 (333605)
Length:
8518
CDS:
588..5846

Additional Resources:

NCBI RefSeq record:
XM_011247833.2
NBCI Gene record:
Frmpd4 (333605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251732 CATAAACCGAAGGCATTATTT pLKO_005 6687 3UTR 100% 15.000 21.000 N Frmpd4 n/a
2 TRCN0000251729 TCAGCGACCTGCGACTATATG pLKO_005 1801 CDS 100% 13.200 18.480 N Frmpd4 n/a
3 TRCN0000251731 CCGCCTTTGTGACTACCATTT pLKO_005 4121 CDS 100% 10.800 15.120 N Frmpd4 n/a
4 TRCN0000265235 ATGTCGTTCAGGAGCGATTTG pLKO_005 1507 CDS 100% 10.800 8.640 N Frmpd4 n/a
5 TRCN0000251730 GTGGACTCCAGGAGGTCAATA pLKO_005 2109 CDS 100% 13.200 9.240 N Frmpd4 n/a
6 TRCN0000153566 GAGGAGCTAAAGTGTCCTTTA pLKO.1 2503 CDS 100% 1.080 0.756 N FRMPD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465554 ACCGCACTCGCACGGCGTGGGCAC pLX_317 7% 65.4% 67.2% V5 (many diffs) n/a
Download CSV