Transcript: Mouse XM_011247983.1

PREDICTED: Mus musculus RAB29, member RAS oncogene family (Rab29), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab29 (226422)
Length:
901
CDS:
443..886

Additional Resources:

NCBI RefSeq record:
XM_011247983.1
NBCI Gene record:
Rab29 (226422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379594 GTCACCAATGCCACTACTTTC pLKO_005 710 CDS 100% 10.800 8.640 N Rab29 n/a
2 TRCN0000102731 CCATGACACGACTCTACTATA pLKO.1 657 CDS 100% 13.200 9.240 N Rab29 n/a
3 TRCN0000382381 GCTTCTGCCTGTGTTATTATG pLKO_005 683 CDS 100% 13.200 9.240 N Rab29 n/a
4 TRCN0000102733 GACTCTACTATAGAGATGCTT pLKO.1 666 CDS 100% 3.000 2.100 N Rab29 n/a
5 TRCN0000102734 CAATGCCACTACTTTCAGCAA pLKO.1 715 CDS 100% 2.640 1.848 N Rab29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02050 pDONR223 100% 65% 57% None (many diffs) n/a
2 ccsbBroad304_02050 pLX_304 0% 65% 57% V5 (many diffs) n/a
3 TRCN0000467837 CAGATACGCTTGTAGGTTTTACTC pLX_317 67.4% 65% 57% V5 (many diffs) n/a
Download CSV