Transcript: Mouse XM_011248147.2

PREDICTED: Mus musculus sorting nexin 16 (Snx16), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx16 (74718)
Length:
1015
CDS:
316..945

Additional Resources:

NCBI RefSeq record:
XM_011248147.2
NBCI Gene record:
Snx16 (74718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277521 TCCTCTCATTAGGACTAAATT pLKO_005 525 CDS 100% 15.000 12.000 N Snx16 n/a
2 TRCN0000215787 CAGATTCATCCATTGAGTATT pLKO.1 554 CDS 100% 13.200 9.240 N Snx16 n/a
3 TRCN0000217593 GACCTTCAACACCTACAATTC pLKO.1 632 CDS 100% 10.800 7.560 N Snx16 n/a
4 TRCN0000177290 GAGACTAACTACCATTTACAA pLKO.1 948 3UTR 100% 5.625 3.938 N Snx16 n/a
5 TRCN0000277589 GAGACTAACTACCATTTACAA pLKO_005 948 3UTR 100% 5.625 3.938 N Snx16 n/a
6 TRCN0000176541 CAGCTTTACAAACAACAGAAA pLKO.1 366 CDS 100% 4.950 2.970 N Snx16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03919 pDONR223 100% 52.5% 54% None (many diffs) n/a
2 ccsbBroad304_03919 pLX_304 0% 52.5% 54% V5 (many diffs) n/a
3 TRCN0000465499 TGATATCTACTCCAGACAAAGCCG pLX_317 18.5% 52.5% 54% V5 (many diffs) n/a
4 ccsbBroadEn_15131 pDONR223 0% 52.5% 54% None (many diffs) n/a
5 ccsbBroad304_15131 pLX_304 0% 52.5% 54% V5 (many diffs) n/a
6 TRCN0000473887 ATGCCACCGGACCTGAGAAGATTG pLX_317 41% 52.5% 54% V5 (many diffs) n/a
Download CSV