Transcript: Mouse XM_011248248.2

PREDICTED: Mus musculus mediator complex subunit 13-like (Med13l), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Med13l (76199)
Length:
9314
CDS:
62..6709

Additional Resources:

NCBI RefSeq record:
XM_011248248.2
NBCI Gene record:
Med13l (76199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111895 CATGCTCTAACCGGGAAGGGA pLKO.1 6700 CDS 100% 0.250 0.350 N Med13l n/a
2 TRCN0000111896 GCCACCGTGATGTTGCTTATA pLKO.1 4296 CDS 100% 13.200 10.560 N Med13l n/a
3 TRCN0000233505 CATCACCTAGCACCTTATTTA pLKO_005 4577 CDS 100% 15.000 10.500 N MED13L n/a
4 TRCN0000111897 CCCAGTCCAATCCAGCTTTAT pLKO.1 5417 CDS 100% 13.200 9.240 N Med13l n/a
5 TRCN0000111898 CCCAACAATGATGACATGTTT pLKO.1 6134 CDS 100% 5.625 3.938 N Med13l n/a
6 TRCN0000111899 GCTCTTCAAAGCAATCCACAA pLKO.1 424 CDS 100% 4.050 2.835 N Med13l n/a
7 TRCN0000016672 CCTCAGCTCCTCCTGCAGCCA pLKO.1 6736 3UTR 100% 0.000 0.000 N LOC285563 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.