Transcript: Mouse XM_011248334.1

PREDICTED: Mus musculus solute carrier family 35, member F3 (Slc35f3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc35f3 (210027)
Length:
3775
CDS:
1040..2455

Additional Resources:

NCBI RefSeq record:
XM_011248334.1
NBCI Gene record:
Slc35f3 (210027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069419 CCTGTACTTACACGCAATAAA pLKO.1 1687 CDS 100% 15.000 21.000 N Slc35f3 n/a
2 TRCN0000069938 GCGATCAAGGAGGATCTGAAA pLKO.1 1127 CDS 100% 4.950 6.930 N LOC382039 n/a
3 TRCN0000069421 CCATTGTACTACGCAGGACAT pLKO.1 1526 CDS 100% 4.050 5.670 N Slc35f3 n/a
4 TRCN0000069942 CCTGCGCATCACAGGCTACTA pLKO.1 1213 CDS 100% 1.650 2.310 N LOC382039 n/a
5 TRCN0000069420 CCTGTAAATGCAGTGGTCGAT pLKO.1 2207 CDS 100% 2.640 2.112 N Slc35f3 n/a
6 TRCN0000069422 CACCAGTCAGATAGTCTTCAA pLKO.1 2233 CDS 100% 4.950 3.465 N Slc35f3 n/a
7 TRCN0000069418 GCTGCAACAAATCATTTGTTT pLKO.1 1743 CDS 100% 0.563 0.394 N Slc35f3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481608 GTGAGTGGACTAAGCCAATCTCCT pLX_317 32.8% 76.3% 77.2% V5 (many diffs) n/a
2 ccsbBroadEn_14403 pDONR223 100% 76.2% 77% None (many diffs) n/a
3 ccsbBroad304_14403 pLX_304 0% 76.2% 77% V5 (many diffs) n/a
Download CSV