Transcript: Mouse XM_011248394.1

PREDICTED: Mus musculus vesicle amine transport protein 1 like (Vat1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vat1l (270097)
Length:
3820
CDS:
135..1403

Additional Resources:

NCBI RefSeq record:
XM_011248394.1
NBCI Gene record:
Vat1l (270097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114319 CCATGAATTTCGTCACCGCAT pLKO.1 613 CDS 100% 2.160 3.024 N Vat1l n/a
2 TRCN0000114316 GCTCCCTTGAAGACAGTATTT pLKO.1 2350 3UTR 100% 13.200 9.240 N Vat1l n/a
3 TRCN0000114318 GCCTGTGGCTTAAACTTCATT pLKO.1 357 CDS 100% 5.625 3.938 N Vat1l n/a
4 TRCN0000114317 GCCTCTACTTTCAAGCATGAA pLKO.1 765 CDS 100% 4.950 3.465 N Vat1l n/a
5 TRCN0000114320 GAGAGACCAAGAGTTTCTTTA pLKO.1 976 CDS 100% 13.200 7.920 N Vat1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03840 pDONR223 100% 76.3% 81.8% None (many diffs) n/a
2 ccsbBroad304_03840 pLX_304 0% 76.3% 81.8% V5 (many diffs) n/a
3 TRCN0000469530 CGCTACACTAATTACGTTCGAACC pLX_317 35.6% 76.3% 81.8% V5 (many diffs) n/a
Download CSV