Transcript: Mouse XM_011248402.1

PREDICTED: Mus musculus WD repeat domain 59 (Wdr59), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr59 (319481)
Length:
2483
CDS:
122..2377

Additional Resources:

NCBI RefSeq record:
XM_011248402.1
NBCI Gene record:
Wdr59 (319481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157812 CCGGAATGTCAATGTGGAGAT pLKO.1 1327 CDS 100% 4.050 5.670 N WDR59 n/a
2 TRCN0000152608 GCCTCGGAAATACCTCAATAT pLKO.1 790 CDS 100% 13.200 9.240 N WDR59 n/a
3 TRCN0000181360 CCAAGGACTATCAACTGGTTA pLKO.1 1011 CDS 100% 4.950 3.465 N Wdr59 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12603 pDONR223 100% 66.9% 72.5% None (many diffs) n/a
2 ccsbBroad304_12603 pLX_304 0% 66.9% 72.5% V5 (many diffs) n/a
Download CSV