Transcript: Mouse XM_011248674.2

PREDICTED: Mus musculus cytoglobin (Cygb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cygb (114886)
Length:
2190
CDS:
243..785

Additional Resources:

NCBI RefSeq record:
XM_011248674.2
NBCI Gene record:
Cygb (114886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105486 AGGTGGAACCTATGTACTTTA pLKO.1 595 CDS 100% 13.200 18.480 N Cygb n/a
2 TRCN0000105485 CCAGTGTATGTGTCCGGTATA pLKO.1 1791 3UTR 100% 10.800 7.560 N Cygb n/a
3 TRCN0000059379 CCTGGTGAGGTTCTTTGTGAA pLKO.1 377 CDS 100% 4.950 3.465 N CYGB n/a
4 TRCN0000105489 CGAGGAATTTGCCAATGACTT pLKO.1 650 CDS 100% 4.950 3.465 N Cygb n/a
5 TRCN0000105488 TGCATGACCCAGACAAGGTAT pLKO.1 529 CDS 100% 4.950 3.465 N Cygb n/a
6 TRCN0000105487 CAGTTTAGACACATGGAGGAT pLKO.1 426 CDS 100% 2.640 1.848 N Cygb n/a
7 TRCN0000059380 GCCCTCAAGCACAAGGTGGAA pLKO.1 582 CDS 100% 0.880 0.528 N CYGB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09397 pDONR223 100% 87.7% 89.4% None (many diffs) n/a
2 ccsbBroad304_09397 pLX_304 0% 87.7% 89.4% V5 (many diffs) n/a
3 TRCN0000491965 TAGGTGAGCCTATTTCAATACAAC pLX_317 71% 87.7% 89.4% V5 (many diffs) n/a
Download CSV