Transcript: Mouse XM_011248780.2

PREDICTED: Mus musculus myotubularin related protein 4 (Mtmr4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtmr4 (170749)
Length:
5282
CDS:
785..4357

Additional Resources:

NCBI RefSeq record:
XM_011248780.2
NBCI Gene record:
Mtmr4 (170749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366469 GCAATAGAAAGGCTTACTTAT pLKO_005 4686 3UTR 100% 13.200 18.480 N Mtmr4 n/a
2 TRCN0000366468 TAGCAAGAGGCCGAGCAATAA pLKO_005 3565 CDS 100% 13.200 18.480 N Mtmr4 n/a
3 TRCN0000080581 CCGAACTGTGAGGTCTTGTTT pLKO.1 1784 CDS 100% 5.625 7.875 N Mtmr4 n/a
4 TRCN0000080582 GCTTCAGATGAGGCTAGACAT pLKO.1 3904 CDS 100% 4.950 3.960 N Mtmr4 n/a
5 TRCN0000375203 AGGTCCCAAGATGATTCATAA pLKO_005 4637 3UTR 100% 13.200 9.240 N Mtmr4 n/a
6 TRCN0000366400 ATACTACTGGATCCATATTAC pLKO_005 2051 CDS 100% 13.200 9.240 N Mtmr4 n/a
7 TRCN0000375201 GAGGATGACTTTACGTGTTTA pLKO_005 3968 CDS 100% 13.200 9.240 N Mtmr4 n/a
8 TRCN0000080578 CCAGTTATTCTGGGCTGTGAA pLKO.1 5056 3UTR 100% 4.950 3.465 N Mtmr4 n/a
9 TRCN0000080580 GCCAGATCAGTGAGTTCTCAT pLKO.1 3450 CDS 100% 4.950 3.465 N Mtmr4 n/a
10 TRCN0000080579 CGGATGATTGACAGTGTGGAA pLKO.1 1004 CDS 100% 2.640 1.848 N Mtmr4 n/a
11 TRCN0000375202 GCGCAATGCTGATGATGAATA pLKO_005 1513 CDS 100% 13.200 7.920 N Mtmr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.