Transcript: Mouse XM_011248923.1

PREDICTED: Mus musculus KDM1 lysine (K)-specific demethylase 6B (Kdm6b), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kdm6b (216850)
Length:
7128
CDS:
885..5810

Additional Resources:

NCBI RefSeq record:
XM_011248923.1
NBCI Gene record:
Kdm6b (216850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236678 TTGAGCACAAACGGAACTATG pLKO_005 1429 CDS 100% 10.800 15.120 N KDM6B n/a
2 TRCN0000236677 AGTCCCACTCACCTCTATTTA pLKO_005 6407 3UTR 100% 15.000 10.500 N KDM6B n/a
3 TRCN0000095264 CCTGTATATGTCTCTTGTTTA pLKO.1 6327 3UTR 100% 13.200 9.240 N Kdm6b n/a
4 TRCN0000095268 CCTCGTCATCTCAGTTCTCTA pLKO.1 3487 CDS 100% 4.950 3.465 N Kdm6b n/a
5 TRCN0000095265 CCTCTGTTCTTGAGGGACAAA pLKO.1 3313 CDS 100% 4.950 3.465 N Kdm6b n/a
6 TRCN0000095266 CCTGTTCGTTACAAGTGAGAA pLKO.1 5633 CDS 100% 4.950 3.465 N Kdm6b n/a
7 TRCN0000095267 GCTGGATGAATCCATTCGGAA pLKO.1 2993 CDS 100% 2.640 1.848 N Kdm6b n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6829 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.