Transcript: Mouse XM_011249508.2

PREDICTED: Mus musculus leucine rich repeat containing 8 family, member B (Lrrc8b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc8b (433926)
Length:
7422
CDS:
1015..3426

Additional Resources:

NCBI RefSeq record:
XM_011249508.2
NBCI Gene record:
Lrrc8b (433926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127465 GCACAATAACATCGCTTACAT pLKO.1 2937 CDS 100% 5.625 4.500 N Lrrc8b n/a
2 TRCN0000127464 GCAGGCATTTACAGGCTATAA pLKO.1 1893 CDS 100% 13.200 9.240 N Lrrc8b n/a
3 TRCN0000127468 GCCTTTCTAGAGGAGAACTTA pLKO.1 2461 CDS 100% 5.625 3.938 N Lrrc8b n/a
4 TRCN0000127467 GCTGTGACCAACAATAACATT pLKO.1 3136 CDS 100% 5.625 3.938 N Lrrc8b n/a
5 TRCN0000127466 GCTACGAGAAACAGCTCCATT pLKO.1 1340 CDS 100% 4.950 3.465 N Lrrc8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07892 pDONR223 100% 83.9% 93.6% None (many diffs) n/a
2 ccsbBroad304_07892 pLX_304 0% 83.9% 93.6% V5 (many diffs) n/a
3 TRCN0000467277 AGGTCTACGGTTGTTGCAACCCAT pLX_317 15.1% 83.9% 93.6% V5 (many diffs) n/a
Download CSV