Transcript: Mouse XM_011249725.2

PREDICTED: Mus musculus ankyrin repeat domain 50 (Ankrd50), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ankrd50 (99696)
Length:
8115
CDS:
973..5256

Additional Resources:

NCBI RefSeq record:
XM_011249725.2
NBCI Gene record:
Ankrd50 (99696)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252909 ACGGGCATTCTCAGATCATTA pLKO_005 4235 CDS 100% 13.200 18.480 N Ankrd50 n/a
2 TRCN0000252905 CCCAATCATGCCGACCAATTT pLKO_005 4183 CDS 100% 13.200 18.480 N Ankrd50 n/a
3 TRCN0000252908 GGAGATGGTGCGGGTACTTAT pLKO_005 3948 CDS 100% 13.200 18.480 N Ankrd50 n/a
4 TRCN0000252906 CTTAGGACACAGCCATAATTC pLKO_005 4695 CDS 100% 13.200 10.560 N Ankrd50 n/a
5 TRCN0000252907 GTCTCCACCACACCGAATAAA pLKO_005 5443 3UTR 100% 15.000 10.500 N Ankrd50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12334 pDONR223 100% 42% 48.8% None (many diffs) n/a
2 ccsbBroad304_12334 pLX_304 0% 42% 48.8% V5 (many diffs) n/a
3 TRCN0000465722 GGGTTTTAACGACCCCGTAGCAAT pLX_317 18.1% 42% 48.8% V5 (many diffs) n/a
Download CSV