Transcript: Mouse XM_011249994.1

PREDICTED: Mus musculus family with sequence similarity 214, member B (Fam214b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam214b (230088)
Length:
3102
CDS:
365..1981

Additional Resources:

NCBI RefSeq record:
XM_011249994.1
NBCI Gene record:
Fam214b (230088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265150 TCACGCCCAAATTGACTATTT pLKO_005 2101 3UTR 100% 13.200 18.480 N Fam214b n/a
2 TRCN0000265149 ATTGGAGCCAGTGGGTCTTAC pLKO_005 1484 CDS 100% 10.800 8.640 N Fam214b n/a
3 TRCN0000192522 GATTTGCACAATCTTGCACAA pLKO.1 929 CDS 100% 4.050 3.240 N Fam214b n/a
4 TRCN0000192447 CCATCCAAGTGACCTTATTTA pLKO.1 1641 CDS 100% 15.000 10.500 N Fam214b n/a
5 TRCN0000265147 CCATCCAAGTGACCTTATTTA pLKO_005 1641 CDS 100% 15.000 10.500 N Fam214b n/a
6 TRCN0000149736 GCACACACTTGACACTGATTT pLKO.1 913 CDS 100% 13.200 9.240 N FAM214B n/a
7 TRCN0000265148 TTGTGGAGCACGGAGGTAATA pLKO_005 738 CDS 100% 13.200 9.240 N Fam214b n/a
8 TRCN0000189961 GCACCATCCAAGTGACCTTAT pLKO.1 1638 CDS 100% 10.800 7.560 N Fam214b n/a
9 TRCN0000283298 ACACCCTGGCTCTCATCAAAT pLKO_005 791 CDS 100% 13.200 7.920 N Fam214b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04196 pDONR223 100% 92.8% 91% None (many diffs) n/a
2 ccsbBroad304_04196 pLX_304 0% 92.8% 91% V5 (many diffs) n/a
3 TRCN0000470376 AACCATATATTTGCGACAGCTCGT pLX_317 26.6% 92.8% 91% V5 (many diffs) n/a
Download CSV