Transcript: Mouse XM_011250035.1

PREDICTED: Mus musculus zinc finger protein 462 (Zfp462), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp462 (242466)
Length:
10285
CDS:
117..7595

Additional Resources:

NCBI RefSeq record:
XM_011250035.1
NBCI Gene record:
Zfp462 (242466)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095831 CGCAACATGATCGACCACATA pLKO.1 6873 CDS 100% 4.950 6.930 N Zfp462 n/a
2 TRCN0000095830 CCGCTGTGATAAGTGTACCTT pLKO.1 6974 CDS 100% 3.000 4.200 N Zfp462 n/a
3 TRCN0000415242 TTAGGACTGAACAATCTATTT pLKO_005 7716 3UTR 100% 13.200 9.240 N ZNF462 n/a
4 TRCN0000095832 GCAGGAACGAAATCCATACAA pLKO.1 7414 CDS 100% 5.625 3.938 N Zfp462 n/a
5 TRCN0000095833 CCCTTAAAGAGCGAAACAGTA pLKO.1 7512 CDS 100% 4.950 3.465 N Zfp462 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12414 pDONR223 100% 29.2% 30.1% None (many diffs) n/a
2 ccsbBroad304_12414 pLX_304 0% 29.2% 30.1% V5 (many diffs) n/a
3 TRCN0000471691 GTTTATACCTGTTCAGACCGAGCT pLX_317 16.5% 29.2% 30.1% V5 (many diffs) n/a
Download CSV