Transcript: Mouse XM_011250060.2

PREDICTED: Mus musculus akirin 2 (Akirin2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akirin2 (433693)
Length:
1565
CDS:
220..825

Additional Resources:

NCBI RefSeq record:
XM_011250060.2
NBCI Gene record:
Akirin2 (433693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250060.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177226 GAAGACATTTAGAAGCTAGTT pLKO.1 497 CDS 100% 4.950 3.960 N Akirin2 n/a
2 TRCN0000167153 CACAGAACAAATTCTGTACAA pLKO.1 444 CDS 100% 0.495 0.396 N AKIRIN2 n/a
3 TRCN0000200141 CGCATGCAGAAGAGAAGACAT pLKO.1 484 CDS 100% 4.950 3.465 N Akirin2 n/a
4 TRCN0000197432 CAGAACAAATTCTGTACAACA pLKO.1 446 CDS 100% 0.495 0.347 N Akirin2 n/a
5 TRCN0000177851 CCACAGAACAAATTCTGTACA pLKO.1 443 CDS 100% 0.495 0.347 N Akirin2 n/a
6 TRCN0000177433 CAGAAGAGAAGACATTTAGAA pLKO.1 490 CDS 100% 5.625 3.375 N Akirin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250060.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03528 pDONR223 100% 90.6% 93.5% None (many diffs) n/a
2 ccsbBroad304_03528 pLX_304 0% 90.6% 93.5% V5 (many diffs) n/a
3 TRCN0000474999 TTGTCTCATCGTCAGAGCGTACTC pLX_317 67.5% 90.6% 93.5% V5 (many diffs) n/a
Download CSV