Transcript: Mouse XM_011250065.2

PREDICTED: Mus musculus regulator of G-protein signaling 3 (Rgs3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgs3 (50780)
Length:
2067
CDS:
51..1826

Additional Resources:

NCBI RefSeq record:
XM_011250065.2
NBCI Gene record:
Rgs3 (50780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037150 GCATACGCTTATTGGCTGCAT pLKO.1 431 CDS 100% 2.640 3.696 N Rgs3 n/a
2 TRCN0000037151 CATTCCAGTTACGGCACCTAT pLKO.1 1347 CDS 100% 4.950 3.960 N Rgs3 n/a
3 TRCN0000418614 TCCACGAGCACTTCTTCTTTC pLKO_005 340 CDS 100% 10.800 7.560 N Rgs3 n/a
4 TRCN0000037152 CCCTAACAAGAGGGAGAAGAA pLKO.1 944 CDS 100% 4.950 3.465 N Rgs3 n/a
5 TRCN0000037153 GAGGATACAATCCCTGAAGAA pLKO.1 1197 CDS 100% 4.950 3.465 N Rgs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06862 pDONR223 100% 31.4% 28.2% None (many diffs) n/a
2 ccsbBroad304_06862 pLX_304 0% 31.4% 28.2% V5 (many diffs) n/a
3 TRCN0000468623 AGCACTGCGTGATGATGACGAAGT pLX_317 15% 31.4% 28.2% V5 (many diffs) n/a
Download CSV