Transcript: Mouse XM_011250239.2

PREDICTED: Mus musculus PHD finger protein 13 (Phf13), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phf13 (230936)
Length:
3059
CDS:
703..1137

Additional Resources:

NCBI RefSeq record:
XM_011250239.2
NBCI Gene record:
Phf13 (230936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202452 GTTTGATATCCGTCGCTCCAA pLKO.1 1077 CDS 100% 2.640 3.696 N Phf13 n/a
2 TRCN0000241823 TGCACCTTCGTCTTGGCATAT pLKO_005 340 5UTR 100% 10.800 8.640 N Phf13 n/a
3 TRCN0000241825 CAGTGGAGCTGGCCATTATTA pLKO_005 2672 3UTR 100% 15.000 10.500 N Phf13 n/a
4 TRCN0000241824 CCGGGACTCCAAGTTTGATAT pLKO_005 1065 CDS 100% 13.200 9.240 N Phf13 n/a
5 TRCN0000241826 AGTCCAATGTCCCGGAAGTTT pLKO_005 1028 CDS 100% 5.625 3.938 N Phf13 n/a
6 TRCN0000241822 GAGAGCTAAGCCCAGTAACTA pLKO_005 531 5UTR 100% 5.625 3.938 N Phf13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09657 pDONR223 100% 43.5% 46.3% None (many diffs) n/a
2 ccsbBroad304_09657 pLX_304 0% 43.5% 46.3% V5 (many diffs) n/a
3 TRCN0000491353 TTACTTGGGCACTCGCTGAATCCC pLX_317 38.4% 43.5% 46.3% V5 (many diffs) n/a
Download CSV