Transcript: Mouse XM_011250305.2

PREDICTED: Mus musculus cyclin L2 (Ccnl2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccnl2 (56036)
Length:
1309
CDS:
554..1231

Additional Resources:

NCBI RefSeq record:
XM_011250305.2
NBCI Gene record:
Ccnl2 (56036)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262720 ACCTAAAGAACCAGATTATAA pLKO_005 1059 CDS 100% 15.000 21.000 N Ccnl2 n/a
2 TRCN0000262718 ACACTAAGTCCTTCGTGAAAC pLKO_005 879 CDS 100% 10.800 15.120 N Ccnl2 n/a
3 TRCN0000071793 CCCTCACAAGATAATCGTTAT pLKO.1 1132 CDS 100% 10.800 15.120 N Ccnl2 n/a
4 TRCN0000071796 GAGACGAATCAGGGATGTCAT pLKO.1 961 CDS 100% 4.950 3.960 N Ccnl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09080 pDONR223 100% 85.7% 90.7% None (many diffs) n/a
2 ccsbBroad304_09080 pLX_304 0% 85.7% 90.7% V5 (many diffs) n/a
3 TRCN0000467606 CAAACTCTCTAGTTGACCTGGGCT pLX_317 60.3% 85.7% 90.7% V5 (many diffs) n/a
Download CSV