Transcript: Mouse XM_011250337.2

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF) 10-like (Arhgef10l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef10l (72754)
Length:
4505
CDS:
158..4000

Additional Resources:

NCBI RefSeq record:
XM_011250337.2
NBCI Gene record:
Arhgef10l (72754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257664 GTACTAGATGCCGCCACTTTG pLKO_005 3131 CDS 100% 10.800 15.120 N Arhgef10l n/a
2 TRCN0000247942 TAGATGTATACAGCGACTATG pLKO_005 1371 CDS 100% 10.800 15.120 N Arhgef10l n/a
3 TRCN0000217893 GTCCATGGTCCTAGATGTATA pLKO.1 1360 CDS 100% 13.200 9.240 N Arhgef10l n/a
4 TRCN0000216672 CTTGGCAAAGATTGGACTAAG pLKO.1 2404 CDS 100% 10.800 7.560 N Arhgef10l n/a
5 TRCN0000247941 GATTACCGTAACCCACTAATG pLKO_005 1172 CDS 100% 10.800 7.560 N Arhgef10l n/a
6 TRCN0000247943 TGGACAAGGCTACCGCCATTT pLKO_005 3886 CDS 100% 10.800 7.560 N Arhgef10l n/a
7 TRCN0000247944 ACTGCCTGCTGAACCTAGAAC pLKO_005 4288 3UTR 100% 4.950 3.465 N Arhgef10l n/a
8 TRCN0000190883 CCTGTGCTCTGCATAGAGTAT pLKO.1 2729 CDS 100% 4.950 3.465 N Arhgef10l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08479 pDONR223 100% 83.6% 88.6% None (many diffs) n/a
2 ccsbBroad304_08479 pLX_304 0% 83.6% 88.6% V5 (many diffs) n/a
3 TRCN0000468535 TACGAAATTCATTTGACTCCTAGA pLX_317 11.3% 83.6% 88.6% V5 (many diffs) n/a
Download CSV